pCMV3-N-OFPSpark Control Vector (N-terminal OFPSpark-tagged)
Cat: CV024
Cat: CV024
Price:
Size:
Number:
- Control for the pCMV3-N-OFPSpark clone.
- Vector sequence is the same as pCMV3-N-OFPSpark, but multiple cloning sites are removed.
- Designed for mammalian expression, stable or transient.
- Hygromycin resistance gene for selection of stable cell lines.
 |
Vector Sequence Download 
|
 |
Caption: The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. |
 |
Caption: The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. |
| Vector Name | pCMV3-N-OFPSpark-CV |
| Vector Size |
6602bp |
| Vector Type | Mammalian Expression Vector |
| Expression Method | Constitutive, Stable / Transient |
| Promoter | CMV |
| Antibiotic Resistance | Kanamycin |
| Selection In Mammalian Cells | Hygromycin |
| Protein Tag | OFPSpark |
| Sequencing Primer |
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG) |
If you couldn't find the specific citation, you can:
