pCMV3-SP-N-Myc Negative Control Vector (N-terminal Myc-tagged)

  • Negative control for the pCMV3-SP-N-Myc clone.
  • Vector sequence is the same as pCMV3-SP-N-Myc, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-SP-N-Myc-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-SP-N-Myc-NCV
 Vector Size

6004bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag Myc
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-SP-N-Myc-NCV (Negative Control Vector) Multiple Cloning Sites

  • The anti-HIV Drug Nelfinavir Mesylate (Viracept) is a Potent Inhibitor of Cell Fusion Caused by the SARS-CoV-2 Spike (S) Glycoprotein Warranting further Evaluation as an Antiviral against COVID-19 infections
    Author
    Musarrat, F;Chouljenko, V;Nabi, R;Dahai, A;Jois, S;
    Year
    2020
    Journal
    bioRxiv
    Application
    expression of Spike
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.