pCMV3-SP-N-Myc Negative Control Vector (N-terminal Myc-tagged)
Cat: CV022
Cat: CV022
Price:
Size:
Number:
- Negative control for the pCMV3-SP-N-Myc clone.
- Vector sequence is the same as pCMV3-SP-N-Myc, but multiple cloning sites are removed.
- Designed for mammalian expression, stable or transient.
- Hygromycin resistance gene for selection of stable cell lines.
 |
Vector Sequence Download 
|
| Vector Name | pCMV3-SP-N-Myc-NCV |
| Vector Size |
6004bp |
| Vector Type | Mammalian Expression Vector |
| Expression Method | Constitutive, Stable / Transient |
| Promoter | CMV |
| Antibiotic Resistance | Kanamycin |
| Selection In Mammalian Cells | Hygromycin |
| Protein Tag | Myc |
| Sequencing Primer |
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG) |
-
The anti-HIV Drug Nelfinavir Mesylate (Viracept) is a Potent Inhibitor of Cell Fusion Caused by the SARS-CoV-2 Spike (S) Glycoprotein Warranting further Evaluation as an Antiviral against COVID-19 infectionsAuthorMusarrat, F;Chouljenko, V;Nabi, R;Dahai, A;Jois, S;Year2020JournalbioRxivApplicationexpression of Spike
If you couldn't find the specific citation, you can:
