pCMV3-N-HA Negative Control Vector (N-terminal HA-tagged)

  • Negative control for the pCMV3-N-HA clone.
  • Vector sequence is the same as pCMV3-N-HA, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-N-HA-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-N-HA-NCV
 Vector Size

5956bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag HA
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-N-HA-NCV (Negative Control Vector) Multiple Cloning Sites

  • GRWD1 promotes cell proliferation and migration in non-small cell lung cancer by activating the Notch pathway
    Author
    Wang, Q;Ren, H;Xu, Y;Jiang, J;Wudu, M;Liu, Z;Su, H;Jiang, X;Zhang, Y;Zhang, B;Qiu, X;
    Year
    2019
    Journal
    Exp. Cell Res.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.