pCMV3-C-OFPSpark Control Vector (C-terminal OFPSpark-tagged)

  • Control for the pCMV3-C-OFPSpark clone.
  • Vector sequence is the same as pCMV3-C-OFPSpark, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV3-C-OFPSpark-CV (Control Vector) Physical Map
Vector Sequence
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope.
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope.
 Vector Name pCMV3-C-OFPSpark-CV
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag OFPSpark
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV3-C-OFPSpark-CV (Control Vector) Multiple Cloning Sites

  • Prostaglandin D2-ethanolamide induces skin cancer apoptosis by suppressing the activity of cellular antioxidants
    Elhassanny, AEM;Ladin, DA;Soliman, E;Albassam, H;Morris, A;Kobet, R;Thayne, K;Burns, C;Danell, AS;Van Dross, R;
    Prostaglandins Other Lipid Mediat.
  • ITGA2 is a target of miR-206 promoting cancer stemness and lung metastasis through enhanced ACLY and CCND1 expression in triple negative breast cancer
    Adorno-Cruz, V;Hoffmann, AD;Liu, X;Wray, B;Keri, RA;
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.