pCMV3-C-Myc Negative Control Vector (C-terminal Myc-tagged)

  • Negative control for the pCMV3-C-Myc clone.
  • Vector sequence is the same as pCMV3-C-Myc, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-C-Myc-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-C-Myc-NCV
 Vector Size

5959bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag Myc
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-C-Myc-NCV (Negative Control Vector) Multiple Cloning Sites

  • Metalloprotease-Dependent Attenuation of BMP Signaling Restricts Cardiac Neural Crest Cell Fate
    Author
    Arai, HN;Sato, F;Yamamoto, T;Woltjen, K;Kiyonari, H;Yoshimoto, Y;Shukunami, C;Akiyama, H;Kist, R;Sehara-Fujisawa, A;
    Year
    2019
    Journal
    Cell Rep
    Application
    expression and template
  • Resveratrol induces depletion of TRAF6 and suppresses prostate cancer cell proliferation and migration
    Author
    Khusbu, FY;Zhou, X;Roy, M;Chen, FZ;Cao, Q;Chen, HC;
    Year
    2019
    Journal
    Int. J. Biochem. Cell Biol.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.