pCMV / hygro-Negative Control Vector (Myc-tagged)

  • Negative control for the pCMV / hygro-Myc clone.
  • sequence is the same as pCMV / hygro-Myc, except multiple cloning sites are reduced.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV / hygro-Negative Control Vector (Myc-tagged) Physical Map
 
Vector Sequence
Download     
 
 
Description
 
 Vector Name pCMV / hygro-Myc
 Vector Size

5558bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Protein Tag GAGCAGAAACTCATCTCAGAAGAGGATCTG
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

 

 
Schematic of pCMV / hygro-Negative Control Vector (Myc-tagged) Multiple Cloning Sites

 

  • Identification of the involvement of LOXL4 in generation of keratocystic odontogenic tumors by RNA-Seq analysis
    Author
    Jiang, WP;Sima, ZH;Wang, HC;Zhang, JY;Sun, LS;Chen, F;Li, TJ;
    Year
    2013
    Journal
    Int J Oral Sci
    Application
    gene expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.