pCMV / hygro-Negative Control Vector (HA-tagged)

  • Negative control for the pCMV / hygro-HA clone.
  • sequence is the same as pCMV / hygro-HA, except multiple cloning sites are reduced.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV / hygro-Negative Control Vector (HA-tagged) Physical Map
Vector Sequence
 Vector Name pCMV / hygro-HA
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV / hygro-Negative Control Vector (HA-tagged) Multiple Cloning Sites

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.