pCMV3-SP-N-His Negative Control Vector (N-terminal His-tagged)

  • Negative control for the pCMV3-SP-N-His clone.
  • Vector sequence is the same as pCMV3-SP-N-His, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-SP-N-His-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-SP-N-His-NCV
 Vector Size

6004bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag His
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-SP-N-His-NCV (Negative Control Vector) Multiple Cloning Sites

  • MMP9 protects against LPS-induced inflammation in osteoblasts
    Author
    Zhang, H;Liu, L;Jiang, C;Pan, K;Deng, J;Wan, C;
    Year
    2019
    Journal
    Innate Immun
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.