SARS-CoV-2 (2019-nCoV) NSP10 Gene ORF cDNA clone expression plasmid

COVID-19 NSP10 Research.
1/1
Price:
Size:
Number:

SARS-CoV-2 (2019-nCoV) NSP10 Gene ORF cDNA clone expression plasmid: General Information

Gene
Species
2019-nCoV
RefSeq ORF Size
423 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 213T/G not causing the amino acid variation.
Description
Full length Clone DNA of SARS-CoV-2 (2019-nCoV) NSP10.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + XbaI(6.1kb+0.43kb)
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Coronavirus NSP10 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SARS-CoV-2 (2019-nCoV) NSP10 Gene ORF cDNA clone expression plasmid: Validated Images

Coronavirus NSP10 Background Information

NSP10 is a major regulator of coronavirus replicase function. NSP10 contains two zinc fingers and binds and stimulates both NSP14 and NSP16 activities. Researchers has found that the nsp10 surface that interacts with nsp14 and nsp16 and possibly other subunits of the viral replication complex may be a target for the development of antiviral compounds against pathogenic coronaviruses.
References
  • Mickaël Bouvet,et al.Coronavirus Nsp10, a Critical Co-factor for Activation of Multiple Replicative Enzymes.THE JOURNAL OF BIOLOGICAL CHEMISTRY.2014
  • Yuanyuan Ma,et al.Structural basis and functional analysis of the SARS coronavirus nsp14-nsp10 complex. Proc Natl Acad Sci USA. 2015
  • Etienne Decroly,et al.Crystal structure and functional analysis of the SARS-coronavirus RNA cap 2'-O-methyltransferase nsp10/nsp16 complex. PLoS Pathog.2011
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.