SARS-CoV-2 (2019-nCoV) NSP3 Gene ORF cDNA clone expression plasmid(Partly)

COVID-19 Plpro Research.
1/1
Price:
Size:
Number:

SARS-CoV-2 (2019-nCoV) NSP3 Gene ORF cDNA clone expression plasmid(Partly): General Information

Gene
Species
2019-nCoV
RefSeq ORF Size
957 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of SARS-CoV-2 (2019-nCoV) Papain-like proteinase/NSP3.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + XbaI(6.1kb+0.96kb)
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Plpro/papain-like protease cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SARS-CoV-2 (2019-nCoV) NSP3 Gene ORF cDNA clone expression plasmid(Partly): Validated Images

Plpro/papain-like protease Background Information

The coronaviral proteases, papain-like protease (PLpro) and 3C-like protease (3CLpro), are attractive antiviral drug targets because they are essential for coronaviral replication. PLpro has the additional function of stripping ubiquitin and ISG15 from host-cell proteins to aid coronaviruses in their evasion of the host innate immune responses. Targeting PLpro with antiviral drugs may have an advantage in not only inhibiting viral replication but also inhibiting the dysregulation of signaling cascades in infected cells that may lead to cell death in surrounding, uninfected cells.
References
  • Yahira M. Báez-Santos.The SARS-coronavirus papain-like protease: Structure, function and inhibition by designed antiviral compounds. Antiviral Research.2015

Plpro/papain-like protease cDNA ORF Clone, SARS, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.