SARS-CoV-2 (2019-nCoV) membrane glycoprotein Gene ORF cDNA clone expression plasmid, C-Flag tag

1/1
Price:
Size:
Number:

SARS-CoV-2 (2019-nCoV) membrane glycoprotein Gene ORF cDNA clone expression plasmid, C-Flag tag: General Information

Gene
Species
SARS-CoV-2
RefSeq ORF Size
708 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of SARS-CoV-2 (2019-nCoV) membrane glycoprotein.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
Restriction Sites
KpnI + NotI(6kb+0.71kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

Coronavirus Membrane cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SARS-CoV-2 (2019-nCoV) membrane glycoprotein Gene ORF cDNA clone expression plasmid, C-Flag tag: Validated Images

Coronavirus Membrane cDNA ORF Clone, MERS-CoV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.