SARS-CoV-2 (2019-nCoV) Methyltransferase/ME Gene ORF cDNA clone expression plasmid

COVID-19 Methyltransferase Research.
1/1
Price:
Size:
Number:

SARS-CoV-2 (2019-nCoV) Methyltransferase/ME Gene ORF cDNA clone expression plasmid: General Information

Gene
Species
2019-nCoV
RefSeq ORF Size
900 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of SARS-CoV-2 (2019-nCoV) Methyltransferase/ME.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + XbaI(6.1kb+0.9kb)
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Coronavirus Methyltransferase/MTase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SARS-CoV-2 (2019-nCoV) Methyltransferase/ME Gene ORF cDNA clone expression plasmid: Validated Images

Coronavirus Methyltransferase/MTase Background Information

Coronavirus encodes the 2′-O-MTase(2'O Methyltransferase) that is composed of the catalytic subunit nsp16 and the stimulatory subunit nsp10 and plays an important role in virus genome replication and evasion from innate immunity during viral infection. Nonstructural protein 16 (NSP16) / viral 2'O-methyltransferase (2'O-MTase) is highly conserved. The conserved 2'O-MTase activity is important for CoV pathogenesis and NSP16 is a conserved universal target for rapid live attenuated vaccine design in an expanding Coronavirus outbreak setting, such as COVID-19. Targeting on the 2'O-methylation pathway on SARS-CoV replication and pathogenesis can be the treatment options for vaccine and anti-viral durgs development which can against SARS-CoV-2,SARS-CoV, MERS-CoV or other RNA and DNA viruses.
References
  • Wang Y, et al., Coronavirus nsp10/nsp16 Methyltransferase Can Be Targeted by nsp10-Derived Peptide In Vitro and In Vivo To Reduce Replication and Pathogenesis.J Virol. 2015
  • Yu Chen, et al., Biochemical and Structural Insights into the Mechanisms of SARS Coronavirus RNA Ribose 2′-O-Methylation by nsp16/nsp10 Protein Complex.PLOS Pathogens.2011
  • Mickaël Bouvet, et al.,Coronavirus Nsp10: a Critical Co-Factor for Activation of Multiple Replicative Enzymes.JBC.2014
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.