CD5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

CD5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1485 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus CD5 antigen.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CD5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

Ly-1 cDNA ORF Clone, Mouse; Ly-12 cDNA ORF Clone, Mouse; Ly-A cDNA ORF Clone, Mouse; Lyt-1 cDNA ORF Clone, Mouse

CD5 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD5 is a member of the CD system. CD5 was found to be widely distributed in T-cells and B1 cells which is a subset of IgM-secreting B cells. CD5 also was found expressed in small lymphocytic lymphoma, hairy cell leukaemia and mantle cell lymphoma cells. CD5 serves to weaken the activating stimulus from the BCR so that the B1 cells can only reflect to the very strong stimuli but not the normal tissue proteins.
Full Name
CD5 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters. 134 (2): 104-12.
  • Kirchgessner H, et al. (2001) The transmembrane adaptor protein TRIM regulates T cell receptor (TCR) expression and TCR-mediated signaling via an association with the TCR zeta chain. J Exp Med. 193 (11): 1269-84.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait