Lentiviral Vector pLV-Untagged

pLV-Untagged Physical Map

Schematic of pLV-Untagged Multiple Cloning Sites

Schematic of pLV-Untagged Multiple Cloning

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Lentiviral Vector pLV-Untagged Information Description

Vector Name pLV-Untagged
Vector Size 6663bp
Vector Type Lentiviral Vector
Promoter Enhancer CMV
Antibiotic Resistance Ampicillin
Protein Tag Untagged
Sequencing Primer F: pLen-F(CTCGTTTAGTGAACCGTCAGAATT)
R: pLen-R(GAACCGGAACCCTTAAACATGT)