Lentiviral Vector pLV-C-OFPSpark®

pLV-C-OFPSpark® Physical Map

Schematic of pLV-C-OFPSpark® Multiple Cloning Sites

Schematic of pLV-C-OFPSpark® Multiple Cloning Sites

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Lentiviral Vector pLV-C-OFPSpark® Information Description

Vector Name pLV-C-OFPSpark®
Vector Size 7353bp
Vector Type Lentiviral Vector
Promoter Enhancer CMV
Antibiotic Resistance Ampicillin
Protein Tag OFPSpark®
Sequencing Primer F: pLen-F(CTCGTTTAGTGAACCGTCAGAATT)
R: pLen-R(GAACCGGAACCCTTAAACATGT)

OFPSpark® Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.