![]() |
Comments for pCMV3-N-HA: |
• CMV promoter: bases 250-837 • Enhancer: bases 838-1385 • SV40 early promoter: bases 2282-2651 • Hygromycin ORF: bases 2669-3694 • pUC origin: bases 4337-5010 • Kanamycin ORF: bases 5084-5899 |
Vector Name | pCMV3-N-HA |
Vector Size | 6041bp |
Vector Type | Mammalian Expression Vector |
Expression Method | Constitutive, Stable / Transient |
Promoter | CMV |
Antibiotic Resistance | Kanamycin |
Selection In Mammalian Cells | Hygromycin |
Protein Tag | HA(TATCCTTACGACGTGCCTGACTACGCC) |
Sequencing Primer | Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG) |
Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.
The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3'. The amino acid sequence is: YPYDVPDYA.
Call Us On
215-583-7898For Product Information and Orders
For Business Collaboration
bd@sinobiological.comFor CRO Services
cro_us@sinobiological.comFor Technical Support
support_us@sinobiological.comFollow Us On