pCMV3-N-GFPSpark® Vector
pCMV3-N-GFPSpark® Physical Map
 |
Comments for pCMV3-N-GFPSpark®: |
| • CMV promoter: bases 250-837 • Enhancer: bases 838-1385 • SV40 early promoter: bases 3969-3338 • Hygromycin ORF: bases 3356-4381 • pUC origin: bases 5024-5697 • Kanamycin ORF: bases 5771-6586 |
Cloning Sites for ORF Inserting
Expression Vector pCMV3-N-GFPSpark® Information Description
| Vector Name | pCMV3-N-GFPSpark® |
| Vector Size | 6728bp |
| Vector Type | Mammalian Expression Vector |
| Expression Method | Constitutive, Stable / Transient |
| Promoter | CMV |
| Antibiotic Resistance | Kanamycin |
| Selection In Mammalian Cells | Hygromycin |
| Protein Tag | GFPSpark® |
| Sequencing Primer | Forward: T7(TAATACGACTCACTATAGGG)； Reverse: BGH(TAGAAGGCACAGTCGAGG) |
GFPSpark® Tag Information
GFPSpark® is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark® is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
