pCMV3-C-His Vector
pCMV3-C-His Physical Map
 |
Comments for pCMV3-C-His: |
| • CMV promoter: bases 250-837 • Enhancer: bases 838-1385 • SV40 early promoter: bases 2345-2714 • Hygromycin ORF: bases 2732-3757 • pUC origin: bases 4400-5073 • Kanamycin ORF: bases 5147-5962 |
Cloning Sites for ORF Inserting
Expression Vector pCMV3-C-His Information Description
| Vector Name | pCMV3-C-His |
| Vector Size | 6104bp |
| Vector Type | Mammalian Expression Vector |
| Expression Method | Constitutive, Stable / Transient |
| Promoter | CMV |
| Antibiotic Resistance | Kanamycin |
| Selection In Mammalian Cells | Hygromycin |
| Protein Tag | His |
| Sequencing Primer | Forward: T7(TAATACGACTCACTATAGGG)； Reverse: BGH(TAGAAGGCACAGTCGAGG) |
His Tag Information
A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.
Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.
