ZDHHC6 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

ZDHHC6 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1230 bp
Description
Full length Clone DNA of Human zinc finger, DHHC-type containing 6
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About ZDHHC6

Entrez Gene ID

ZDHHC6 cDNA ORF Clone, Human, untagged: Alternative Names

DHHC-6 cDNA ORF Clone, Human; ZNF376 cDNA ORF Clone, Human

ZDHHC6 Background Information

Full Name
zinc finger, DHHC-type containing 6

ZDHHC6 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait