ZDHHC6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

ZDHHC6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1242 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus zinc finger, DHHC domain containing 6.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

ZDHHC6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

2400007G07Rik cDNA ORF Clone, Mouse; 5930409M18Rik cDNA ORF Clone, Mouse; AI462345 cDNA ORF Clone, Mouse; C77369 cDNA ORF Clone, Mouse

ZDHHC6 Background Information

Full Name
zinc finger, DHHC-type containing 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait