SLC39A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

SLC39A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1983 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus solute carrier family 39 (zinc transporter), member 4.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

SLC39A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

1600025H15Rik cDNA ORF Clone, Mouse; AU041686 cDNA ORF Clone, Mouse; AWMS2 cDNA ORF Clone, Mouse; ZIP4 cDNA ORF Clone, Mouse

SLC39A4 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait