PDRG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

PDRG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
402 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus p53 and DNA damage regulated 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

PDRG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

1110004D19Rik cDNA ORF Clone, Mouse; AU020945 cDNA ORF Clone, Mouse; AV006589 cDNA ORF Clone, Mouse; Pdrg cDNA ORF Clone, Mouse

PDRG1 Background Information

PDRG1, also known as C2orf126, belongs to theprefoldin subunit beta family. It is predominantly expressed in normal testis and exhibits reduced but detectable expression in other organs. PDRG1 may play a role in chaperone-mediated protein folding. PDRG1 is overexpressed in tumors relative to normal tissues. Its expression is upregulated in multiple malignancies including cancers of the colon, rectum, ovary, lung, stomach, breast and uterus when compared to their respective matched normal tissues. Thus PDRG1 is a high-value novel tumor marker that could play a role in cancer development and/or progression.
Full Name
p53 and DNA-damage regulated 1
References
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Jiang L. et al., 2011, Cancer Biol Ther. 11 (6): 567-73.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait