TLR6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

1/1
Price:
Size:
Number:

TLR6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2421 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse toll-like receptor 6 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI (6kb + 2.51kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TLR6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TLR6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Validated Images

TLR6 Background Information

Toll like receptors (TLRs) are involved in the modulation of diverse host genes expression through a complex network of signalling events that allow for an appropriate response to a microbial pathogen. The deregulated TLR6 expression may potentiate TLR2-mediated liver inflammation in NAFLD pathogenesis, and also serve as a potential peripheral biomarker of obesity-related NASH. Current evidence suggests that gut dysbiosis drives obesity and non-alcoholic fatty liver disease (NAFLD) pathogenesis.
Full Name
toll like receptor 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait