1110004F10RIK cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

1110004F10RIK cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Mouse RIKEN cDNA 1110004F10 gene with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

1110004F10RIK cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

sid2057 cDNA ORF Clone, Mouse; sid2057p cDNA ORF Clone, Mouse; Smacp cDNA ORF Clone, Mouse; Smap cDNA ORF Clone, Mouse

1110004F10RIK Background Information

Full Name
RIKEN cDNA 1110004F10 gene
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait