0610007P14Rik cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

0610007P14Rik cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
423 bp
Description
Full length Clone DNA of Mouse RIKEN cDNA 0610007P14 gene
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

0610007P14Rik cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

1190004E09Rik cDNA ORF Clone, Mouse; AU019315 cDNA ORF Clone, Mouse; C77855 cDNA ORF Clone, Mouse; ORF11 cDNA ORF Clone, Mouse

0610007P14Rik Background Information

Full Name
RIKEN cDNA 0610007P14 gene
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait