MRPL42 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

MRPL42 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
429 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus mitochondrial ribosomal protein L42.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

MRPL42 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

2700009F22Rik cDNA ORF Clone, Mouse; 2900055D03Rik cDNA ORF Clone, Mouse; D10Ertd322e cDNA ORF Clone, Mouse; HSPC204 cDNA ORF Clone, Mouse; L31mt cDNA ORF Clone, Mouse; MRP-L31 cDNA ORF Clone, Mouse; PTD007 cDNA ORF Clone, Mouse; Rpml31 cDNA ORF Clone, Mouse

MRPL42 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait