MOB3B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

MOB3B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
651 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus MOB kinase activator 3B.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

MOB3B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

8430436F23Rik cDNA ORF Clone, Mouse; A430018A01Rik cDNA ORF Clone, Mouse; Mobkl2b cDNA ORF Clone, Mouse

MOB3B Background Information

Mps one binder (MOB) proteins are integral components of signaling pathways that control important cellular processes, such as mitotic exit, centrosome duplication, apoptosis, and cell proliferation.The low levels of hMOB3B are closely associated with aggressive clinicopathologic features in patients with PCa. hMOB3B may act as a tumor suppressor in human PCa.
Full Name
MOB kinase activator 3B
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait