LRCH4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

LRCH4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1950 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus leucine-rich repeats and calponin homology (CH) domain containing 4.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

LRCH4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

2810008P14Rik cDNA ORF Clone, Mouse; 2900069C24Rik cDNA ORF Clone, Mouse; AI558103 cDNA ORF Clone, Mouse; LRN cDNA ORF Clone, Mouse; LRRN4 cDNA ORF Clone, Mouse; mFLJ00248 cDNA ORF Clone, Mouse; SAP25 cDNA ORF Clone, Mouse

LRCH4 Background Information

Full Name
leucine-rich repeats and calponin homology (CH) domain containing 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait