LCP2/SLP-76 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

LCP2/SLP-76 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1602 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus lymphocyte cytosolic protein 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

LCP2/SLP-76 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AI323664 cDNA ORF Clone, Mouse; BB161688 cDNA ORF Clone, Mouse; SLP-76 cDNA ORF Clone, Mouse; SLP76 cDNA ORF Clone, Mouse; twm cDNA ORF Clone, Mouse

LCP2/SLP-76 Background Information

Full Name
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait