SRSF7 cDNA ORF Clone, Human, N-GFPSpark® tag

1/1
Price:
Size:
Number:

SRSF7 cDNA ORF Clone, Human, N-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1446 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1431T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human serine/arginine-rich splicing factor 7 with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + NotI(6kb+1.45kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SRSF7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRSF7 cDNA ORF Clone, Human, N-GFPSpark® tag: Validated Images

SRSF7 cDNA ORF Clone, Human, N-GFPSpark® tag: Alternative Names

9G8 cDNA ORF Clone, Human; AAG3 cDNA ORF Clone, Human; SFRS7 cDNA ORF Clone, Human

SRSF7 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait