SRSF7 cDNA ORF Clone, Human, C-OFPSpark® tag

Price:
Size:
Number:

SRSF7 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
717 bp
Description
Full length Clone DNA of Human serine/arginine-rich splicing factor 7 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SRSF7 cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

9G8 cDNA ORF Clone, Human; AAG3 cDNA ORF Clone, Human; SFRS7 cDNA ORF Clone, Human

SRSF7 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait