PAK2 cDNA ORF Clone, Human, N-HA tag

1/1
Price:
Size:
Number:

PAK2 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1617 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human p21 protein (Cdc42/Rac)-activated kinase 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.62kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PAK2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAK2 cDNA ORF Clone, Human, N-HA tag: Validated Images

PAK2 cDNA ORF Clone, Human, N-HA tag: Alternative Names

PAK65 cDNA ORF Clone, Human; PAKgamma cDNA ORF Clone, Human
  • Homophilic CD44 interactions mediate tumor cell aggregation and polyclonal metastasis in patient-derived breast cancer models
    Author
    Liu, X;Taftaf, R;Kawaguchi, M;Chang, YF;Chen, W;Entenberg, D;Zhang, Y;Gerratana, L;Huang, S;Patel, DB;Tsui, E;Adorno-Cruz, V;Chirieleison, SM;Cao, Y;Harney, AS;Patel, S;Patsialou, A;Shen, Y;Avril, S;Gilmore, HL;Lathia, JD;Abbott, DW;Cristofanilli, M;Condeelis, JS;Liu, H;
    Year
    2018
    Journal
    Cancer Discov
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait