LRP6 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

LRP6 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4842 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human low density lipoprotein receptor-related protein 6
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6.1kb+4.84kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LRP6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LRP6 cDNA ORF Clone, Human, untagged: Validated Images

LRP6 cDNA ORF Clone, Human, untagged: Alternative Names

ADCAD2 cDNA ORF Clone, Human

LRP6 Background Information

Lipoprotein receptor-related protein 6 (LRP6) binds to Wnt ligands to transduce signal by stabilization of beta-catenin, which has been involved in the regulation of embryonic development and metabolism et al.Low density lipoprotein (LDL) receptor-related protein-6 (LRP6) is an important co-receptor of Wnt pathway, which plays a predominant role in development and progression of colorectal cancer.This gene, termed LDL receptor-related protein 6 (LRP6), encodes a transmembrane protein which has 71% identity and is structurally similar to the protein encoded by LRP5, a proposed candidate gene for type 1 diabetes located on human chromosome 11q13. LRP6 maps to human chromosome 12p11-p13.
Full Name
LDL receptor related protein 6
  • A novel high-content imaging-based technique for measuring binding of Dickkopf-1 to low-density lipoprotein receptor-related protein 6
    Author
    Priestley, RS;Cheung, J;Murphy, EJ;Ehebauer, MT;Davis, JB;Di Daniel, E;
    Year
    2019
    Journal
    J Pharmacol Toxicol Methods
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait