CEACAM5 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

CEACAM5 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2109 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human carcinoembryonic antigen-related cell adhesion molecule 5.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 2.09kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CEACAM5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CEACAM5 cDNA ORF Clone, Human, untagged: Alternative Names

CD66e cDNA ORF Clone, Human; CEA cDNA ORF Clone, Human

CEACAM5 Background Information

CEACAM5, also known as CEA or D66e, belongs to the large CEACAM subfamily of immunoglobulin superfamily. CEACAM5 is expressed primarily by epithelial cells, and is synthesized as a glycoprotein with a MW of 18 kDa comprising 6% carbohydrate. CEACAM5 contains one Ig-like V-type domain at the N-terminus, followed by six Ig-like C2-type domain and a GPI anchor, and exists as a homodimer. CEACAM5 and CEACAM6 are overexpressed in many cancers and are associated with adhesion and invasion. CEACAM5 can mediate cell-cell adhesion through homotypic and heterotypic interactions. It functions as a homotypic intercellular adhesion molecule and serves as a widely used tumor marker, since it is expressed at higher levels in tumorous tissues than in corresponding normal tissues. CEACAM5 has also been shown to contribute to tumorigenicity by inhibiting cellular differentiation. In addition, CEACAM5 is identified as the host receptor for the Dr family of adhesins of E.Coli, and the binding of E.coli Dr adhesins leads to dissociation of the CEACAM5 homodimer.
Full Name
carcinoembryonic antigen-related cell adhesion molecule 5
References
  • Baczyska D, et al. (2003) The tumorigenic potential of human CX-1 colon adenocarcinoma cells depends on carcinoembryonic antigen (CEACAM5) expression. Cell Mol Biol Lett. 8(2): 471-86.
  • Blumenthal RD, et al. (2005) Inhibition of adhesion, invasion, and metastasis by antibodies targeting CEACAM6 (NCA-90) and CEACAM5 (Carcinoembryonic Antigen). Cancer Res. 65(19): 8809-17.
  • Liebig B, et al. (2005) Forced expression of deltaN-TCF-1B in colon cancer derived cell lines is accompanied by the induction of CEACAM5/6 and mesothelin. Cancer Lett. 223(1): 159-67.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait