XRCC1/APLF cDNA ORF Clone, Human, N-His tag

1/1
Price:
Size:
Number:

XRCC1/APLF cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1581 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human aprataxin and PNKP like factor with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.58kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

XRCC1/APLF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

XRCC1/APLF cDNA ORF Clone, Human, N-His tag: Validated Images

XRCC1/APLF cDNA ORF Clone, Human, N-His tag: Alternative Names

APFL cDNA ORF Clone, Human; C2orf13 cDNA ORF Clone, Human; PALF cDNA ORF Clone, Human; Xip1 cDNA ORF Clone, Human; ZCCHH1 cDNA ORF Clone, Human
  • Triptolide interferes with XRCC1/PARP1-mediated DNA repair and confers sensitization of triple-negative breast cancer cells to cisplatin
    Author
    Zhang, Z;Sun, C;Zhang, L;Chi, X;Ji, J;Gao, X;Wang, Y;Zhao, Z;Liu, L;Cao, X;Yang, Y;Mao, W;
    Year
    2019
    Journal
    Biomedicine & Pharmacotherapy
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait