ABO cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

ABO cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Human ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ABO cDNA ORF Clone, Human, C-Myc tag: Alternative Names

A3GALNT cDNA ORF Clone, Human; A3GALT1 cDNA ORF Clone, Human; GTB cDNA ORF Clone, Human; NAGAT cDNA ORF Clone, Human

ABO Background Information

ABO (ABO, Alpha 1-3-N-Acetylgalactosaminyltransferase And Alpha 1-3-Galactosyltransferase) is a Protein Coding gene. Homologous glycosyltransferases α-(1→3)-N-acetylgalactosaminyltransferase (GTA) and α-(1→3)-galactosyltransferase (GTB) catalyze the final step in ABO(H) blood group A and B antigen synthesis through sugar transfer from activated donor to the H antigen acceptor. These enzymes have a GT-A fold type with characteristic mobile polypeptide loops that cover the active site upon substrate binding. The homologous glycosyltransferases α-1,3-N-acetylgalactosaminyltransferase (GTA) and α-1,3-galactosyltransferase (GTB) carry out the final synthetic step of the closely related human ABO(H) blood group A and B antigens.
Full Name
ABO blood group
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait