Adracalin cDNA ORF Clone, Human, N-GFPSpark® tag

Price:
Size:
Number:

Adracalin cDNA ORF Clone, Human, N-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1641 bp
Description
Full length Clone DNA of Human achalasia, adrenocortical insufficiency, alacrimia with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Adracalin cDNA ORF Clone, Human, N-GFPSpark® tag: Alternative Names

AAA cDNA ORF Clone, Human; AAASb cDNA ORF Clone, Human; ADRACALA cDNA ORF Clone, Human; ADRACALIN cDNA ORF Clone, Human; ALADIN cDNA ORF Clone, Human; GL003 cDNA ORF Clone, Human

Adracalin Background Information

Full Name
achalasia, adrenocortical insufficiency, alacrimia
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait