ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, C-OFPSpark® tag

Price:
Size:
Number:

ATP6V0D1/VPATPD cDNA ORF Clone, Ferret, C-OFPSpark® tag: General Information

Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Description
Full length Clone DNA of Ferret ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ATP6V0D1/VPATPD Background Information

In the epididymis and vas deferens, the vacuolar H(+)ATPase (V-ATPase), located in the apical pole of narrow and clear cells, is required to establish an acidic luminal pH. Low pH is important for the maturation of sperm and their storage in a quiescent state. The V-ATPase also participates in the acidification of intracellular organelles. The V-ATPase contains many subunits, and several of these subunits have multiple isoforms. Subunits ATP6VA2 and ATP6V1A were detected in intracellular structures closely associated but not identical to the TGN of principal cells and narrow/clear cells, and subunit ATP6VD1 was strongly expressed in the apical membrane of principal cells in the apparent absence of other V-ATPase subunits. In principal cells, the ATP6VD1 isoform may have a physiological function that is distinct from its role in proton transport via the V-ATPase complex. The agouti-related protein (AgRP) is an orexigenic peptide that plays a significant role in the regulation of energy balance. Using an elaborate in vitro screening approach, we show here that two adjacent enhancers inside the first intron of the neighboring (1.4 kb downstream) ATPase gene (ATP6VD1) modulate the human AgRP promoter with profound spatiotemporal variation despite their diminutive sizes (221 and 231 nt). In transgenic mice, the proximal enhancer displayed specificity for the testis, tail, and ears, and the distal one for the testis, front feet, bone, heart, muscle, brain, spinal cord, and tongue, while dietary fat and overnight fasting had differential effects on enhancer activities. Spatiotemporal expression of the human AgRP gene is influenced by diversified primate-specific intronic sequences in its neighboring ATP6VD1 gene.
Full Name
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait