EDEM2 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

EDEM2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1626 bp
Description
Full length Clone DNA of Human ER degradation enhancer, mannosidase alpha-like 2
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EDEM2 cDNA ORF Clone, Human, untagged: Alternative Names

bA4204.1 cDNA ORF Clone, Human; C20orf31 cDNA ORF Clone, Human; C20orf49 cDNA ORF Clone, Human; UNQ573/PRO1135 cDNA ORF Clone, Human

EDEM2 Background Information

EDEM2, also known as C2orf31, belongs to a family of proteins involved in ER-associated degradation (ERAD) of glycoproteins. In the endoplasmic reticulum (ER), misfolded proteins are retrotranslocated to the cytosol and degraded by the proteasome. Early in this pathway, a proposed lumenal ER lectin, EDEM, recognizes misfolded glycoproteins in the ER, disengages the nascent molecules from the folding pathway, and facilitates their targeting for disposal. In humans there are a total of three EDEM homologs. The amino acid sequences of these proteins are different from other lectins but are closely related to the Class I mannosidases (family 47 glycosidases). EDEM2 is one of the EDEM homologs. Overexpression of EDEM2 accelerates the degradation of misfolded alpha1-antitrypsin, indicating that the protein is involved in ERAD.
Full Name
ER degradation enhancer, mannosidase alpha-like 2
References
  • Mast SW. et al., 2005, Glycobiology. 15 (4): 421-36.
  • Olivari S. et al., 2005, J Biol Chem. 280 (4): 2424-8.
  • Ota T. et al., 2004, Nat Genet. 36 (1): 40-5.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait