DOK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

DOK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus docking protein 3.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

DOK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AI450713 cDNA ORF Clone, Mouse; Dokl cDNA ORF Clone, Mouse

DOK3 Background Information

DPF3 is associated with the BAF chromatin remodeling complex and binds methylated and acetylated lysine residues of histone 3 and 4. DPF3 may represent the first plant homeodomains that bind acetylated lysines, a feature previously only shown for the bromodomain. DPF3 adds a further layer of complexity to the BAF complex by representing a tissue-specific anchor between histone acetylations as well as methylations and chromatin remodeling. DOK3 protein negatively regulates LPS responses and endotoxin tolerance in mice. DOK3 as a nonredundant regulator of PC differentiation by up-regulating PD-1 ligand expression through the attenuation of calcium signaling.
Full Name
docking protein 3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait