Chymotrypsin-like protease Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

Chymotrypsin-like protease Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
795 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus chymotrypsin-like.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Chymotrypsin-like protease Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

0910001G08Rik cDNA ORF Clone, Mouse; 1810004D15Rik cDNA ORF Clone, Mouse; AV005227 cDNA ORF Clone, Mouse; chymopasin cDNA ORF Clone, Mouse; Ctra-1 cDNA ORF Clone, Mouse; Ctra1 cDNA ORF Clone, Mouse; mFLJ00366 cDNA ORF Clone, Mouse

Chymotrypsin-like protease Background Information

CTRL-1, also known as chymotrypsin-like protease, belongs to thepeptidase S1 family. CTRL-1 contains 1peptidase S1 domain. Its expression is increased in preeclampsia (PE). Placental-derived chymotrypsin-like protease is responsible for inducing endothelial inflammatory phenotypic changes possibly by upregulation of cell adhesion molecule expressions, activation of cellular protease, and induction of extracellular regulated kinase phosphorylation. Activated microglia have been observed in various neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis, and multiple sclerosis. Five structurally distinct inhibitors that are known to inhibit chymotrypsin-like proteases were partially protective. They might represent a novel class of drugs with benefit in diseases where overactivity of microglia contributes to the pathogenesis.
Full Name
chymotrypsin-like
References
  • Yang Gu. et al., 2009, Reprod Sci. 16 (9): 905-13.
  • Klegeris A. et al., 2005, Glia. 51 (1):56-64.
  • Caroline V. Bamford. et al., 2007, nfect Immun. 75 (9): 4364-72.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait