ABO Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

ABO Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

ABO Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

A3GALNT cDNA ORF Clone, Human; A3GALT1 cDNA ORF Clone, Human; GTB cDNA ORF Clone, Human; NAGAT cDNA ORF Clone, Human

ABO Background Information

ABO (ABO, Alpha 1-3-N-Acetylgalactosaminyltransferase And Alpha 1-3-Galactosyltransferase) is a Protein Coding gene. Homologous glycosyltransferases α-(1→3)-N-acetylgalactosaminyltransferase (GTA) and α-(1→3)-galactosyltransferase (GTB) catalyze the final step in ABO(H) blood group A and B antigen synthesis through sugar transfer from activated donor to the H antigen acceptor. These enzymes have a GT-A fold type with characteristic mobile polypeptide loops that cover the active site upon substrate binding. The homologous glycosyltransferases α-1,3-N-acetylgalactosaminyltransferase (GTA) and α-1,3-galactosyltransferase (GTB) carry out the final synthetic step of the closely related human ABO(H) blood group A and B antigens.
Full Name
ABO blood group
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait