ABCD4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

ABCD4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1821 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens ATP binding cassette subfamily D member 4
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

More Information About ABCD4

Entrez Gene ID

ABCD4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

ABC41 cDNA ORF Clone, Human; EST352188 cDNA ORF Clone, Human; MAHCJ cDNA ORF Clone, Human; P70R cDNA ORF Clone, Human; P79R cDNA ORF Clone, Human; PMP69 cDNA ORF Clone, Human; PXMP1L cDNA ORF Clone, Human

ABCD4 Background Information

Full Name
ATP-binding cassette, sub-family D (ALD), member 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait