uPAR cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10925-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All uPAR Reagents
CRO Services

All uPAR Reagents
uPAR cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human plasminogen activator, urokinase receptor , transcript variant 1 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XbaI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
uPAR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

uPAR cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human PLAUR/CD87 Gene Plasmid Map 7371
uPAR cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD87 cDNA ORF Clone, Human;U-PAR cDNA ORF Clone, Human;UPAR cDNA ORF Clone, Human;URKR cDNA ORF Clone, Human
uPAR Background Information

Urokinase plasminogen activator (uPA) and/or its receptor (uPAR) are essential for metastasis, and overexpression of these molecules is strongly correlated with poor prognosis in a variety of malignant tumours. uPAR and uPA levels in both resected tumor tissue and plasma are of independent prognostic significance for patient survival in several types of human cancer. This system has classically been thought to drive tumor progression by mediating directed extracellular proteolysis on the surface of migrating or invading cells, and intervening with this proteolysis by targeting uPAR has been proposed to represent a novel approach for inhibiting tumor progression. uPAR, also known as PLAUR or CD87, has been implicated in the growth, metastasis, and angiogenesis of several solid and hemotologic malignancies. uPAR is a highly glycosylated, 55-60kDa integral membrane protein linked to the plasma membrane by a glycosylphosphatidylinositol (GPI) anchor. It is part of a cell surface system that also consists of the serine protease uPA and several specific inhibitors (plasminogen activator inhibitors 1 and 2). Additionally, the analysis of CD87 (urokinase-type plasminogen activator receptor - uPAR) expression has a potential role in the diagnostic or prognostic work-up of several hematological malignancies, particularly acute leukemia and multiple myeloma.

Full Name
plasminogen activator, urokinase receptor
References
  • Romer J, et al. (2004) The urokinase receptor as a potential target in cancer therapy. Curr Pharm Des. 10(19): 2359-76.
  • Bn MC, et al. (2004) CD87 (urokinase-type plasminogen activator receptor), function and pathology in hematological disorders: a review. Leukemia. 18(3): 394-400.
  • Pillay V, et al. (2007) The urokinase plasminogen activator receptor as a gene therapy target for cancer. Trends Biotechnol. 25(1): 33-9.
  • Mazar AP. (2008) Urokinase plasminogen activator receptor choreographs multiple ligand interactions: implications for tumor progression and therapy. Clin Cancer Res. 14(18): 5649-55.
  • uPAR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    uPAR cDNA ORF Clone in Cloning Vector, Mouse MG50160-M
    uPAR cDNA ORF Clone, Mouse, untagged MG50160-UT
    uPAR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50160-ACGLN
    uPAR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50160-ACG
    uPAR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50160-ACR
    uPAR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50160-CF
    uPAR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50160-NF
    uPAR cDNA ORF Clone, Mouse, C-His tag MG50160-CH
    uPAR cDNA ORF Clone, Mouse, N-His tag MG50160-NH
    uPAR cDNA ORF Clone, Mouse, C-HA tag MG50160-CY
    uPAR cDNA ORF Clone, Mouse, N-HA tag MG50160-NY
    uPAR cDNA ORF Clone, Mouse, C-Myc tag MG50160-CM
    uPAR cDNA ORF Clone, Mouse, N-Myc tag MG50160-NM
    uPAR qPCR Primer Pairs, Mouse MP200190

    uPAR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    uPAR cDNA ORF Clone in Cloning Vector, Human HG10925-M
    uPAR cDNA ORF Clone, Human, untagged HG10925-UT
    uPAR cDNA ORF Clone, Human, C-GFPSpark® tag HG10925-ACG
    uPAR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10925-ACGLN
    uPAR cDNA ORF Clone, Human, C-OFPSpark® tag HG10925-ACR
    uPAR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10925-CF
    uPAR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10925-NF
    uPAR cDNA ORF Clone, Human, C-His tag HG10925-CH
    uPAR cDNA ORF Clone, Human, N-His tag HG10925-NH
    uPAR cDNA ORF Clone, Human, C-HA tag HG10925-CY
    uPAR cDNA ORF Clone, Human, N-HA tag HG10925-NY
    uPAR cDNA ORF Clone, Human, C-Myc tag HG10925-CM
    uPAR cDNA ORF Clone, Human, N-Myc tag HG10925-NM
    uPAR qPCR Primer Pairs, Human HP100807
    info info
    添加购物车成功! 添加购物车失败!