LAIR1 cDNA ORF Clone, Rat, N-HA tag

Price:
Size:
Number:

LAIR1 cDNA ORF Clone, Rat, N-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Rat leukocyte-associated immunoglobulin-like receptor 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LAIR1 Background Information

Leukocyte associated Ig-like receptor-1 (LAIR1) is a surface molecule expressed on human mononuclear leukocytes that functions as an inhibitory receptor on human NK cells. In addition to NK cells, LAIR1 is expressed on T cells, B cells, macrophages, and dendritic cells. It is predicted to mediate inhibitory functions based on the presence of immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in its cytoplasmic domain. Cross-linking of LAIR1 on human T cell clones results in inhibition of cytotoxicity only in T cell clones that lack CD28 and are able to spontaneously lyse certain targets in vitro. Moreover, the cytolytic activity of freshly isolated T cells, which is thought to be mainly due to "effector" T cells, can be inhibited by anti-LAIR1 mAb. Thus, LAIR1 functions as an inhibitory receptor not only on NK cells, but also on human T cells. This indicates that LAIR1 provides a mechanism of regulation of effector T cells and may play a role in the inhibition of unwanted bystander responses mediated by Ag-specific T cells.
Full Name
leukocyte-associated immunoglobulin-like receptor 1
References
  • Meyaard L, et al. (1999) Leukocyte-associated Ig-like receptor-1 functions as an inhibitory receptor on cytotoxic T cells. J Immunol. 162 (10): 5800-4.
  • Meyaard L, et al. (2001) The epithelial cellular adhesion molecule (Ep-CAM) is a ligand for the leukocyte-associated immunoglobulin-like receptor (LAIR). J Exp Med. 194 (1): 107-12.
  • Xu M, et al. (2000) Identification and characterization of leukocyte-associated Ig-like receptor-1 as a major anchor protein of tyrosine phosphatase SHP-1 in hematopoietic cells. J Biol Chem. 275 (23): 17440-6.

LAIR1 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait