PIK3CB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

PIK3CB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3213 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

PIK3CB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

P110BETA cDNA ORF Clone, Human; PI3K cDNA ORF Clone, Human; PI3KBETA cDNA ORF Clone, Human; PIK3C1 cDNA ORF Clone, Human

PIK3CB Background Information

PIK3CB gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants.
Full Name
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
References
  • Draaisma K, Wijnenga MMJ, Weenink B, et al. PI3 kinase mutations and mutational load as poor prognostic markers in diffuse glioma patients. Acta Neuropathologica Communications.

PIK3CB cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait