Quick Order

pCMV3-N-OFPSpark Control Vector (N-terminal OFPSpark-tagged)

    DatasheetReviewsRelated ProductsProtocols
    • Control for the pCMV3-N-OFPSpark clone.
    • Vector sequence is the same as pCMV3-N-OFPSpark, but multiple cloning sites are removed.
    • Designed for mammalian expression, stable or transient.
    • Hygromycin resistance gene for selection of stable cell lines.
     
    pCMV3-N-OFPSpark-CV (Control Vector) Physical Map
     
    Vector Sequence
    Download     
    Caption:
    The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope.
    Caption:
    The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope.
     
    Description
     
     Vector Name pCMV3-N-OFPSpark-CV
     Vector Size

    6662bp

     Vector Type Mammalian Expression Vector
     Expression Method Constitutive, Stable / Transient
     Promoter CMV
     Antibiotic Resistance Kanamycin
     Selection In Mammalian Cells Hygromycin
     Protein Tag OFPSpark
     Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
     
    Schematic of pCMV3-N-OFPSpark-CV (Control Vector) Multiple Cloning Sites

    Size / Price
    Catalog: CV024
    List Price: 
    Price:      (You Save: )
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"