pCMV3-N-Myc Negative Control Vector (N-terminal Myc-tagged)

  • Negative control for the pCMV3-N-Myc clone.
  • Vector sequence is the same as pCMV3-N-Myc, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-N-Myc-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-N-Myc-NCV
 Vector Size

6019bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag Myc
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-N-Myc-NCV (Negative Control Vector) Multiple Cloning Sites

Add to Cart Successfully Add to Cart Failed