Quick Order

Text Size:AAA

pCMV3-N-FLAG Negative Control Vector (N-terminal FLAG-tagged)

DatasheetReviewsRelated ProductsProtocols
  • Negative control for the pCMV3-N-FLAG clone.
  • Vector sequence is the same as pCMV3-N-FLAG, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV3-N-FLAG-NCV (Negative Control Vector) Physical Map
Vector Sequence
 Vector Name pCMV3-N-FLAG-NCV
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance


 Selection In Mammalian Cells Hygromycin
 Protein Tag FLAG
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV3-N-FLAG-NCV (Negative Control Vector) Multiple Cloning Sites

Size / Price
Catalog: CV016
List Price: 
Price:      (You Save: )
Availability5 Business days
Bulk Discount InquiryAdd to Cart
Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.