Quick Order

Text Size:AAA

pCMV3-C-GFPSpark Control Vector (C-terminal GFPSpark-tagged)

DatasheetReviewsRelated ProductsProtocols
  • Control for the pCMV3-C-GFPSpark clone.
  • Vector sequence is the same as pCMV3-C-GFPSpark, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-C-GFPSpark-CV (Control Vector) Physical Map
 
Vector Sequence
Download     
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope.
 
Description
 
 Vector Name pCMV3-C-GFPSpark-CV
 Vector Size

6703bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag GFPSpark
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-C-GFPSpark-CV (Control Vector) Multiple Cloning Sites

Size / Price
Catalog: CV026
List Price: 
Price:      (You Save: )
Quantity:+-
Availability5 Business days
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"